| RHF Joke Archives |

This is original.

Dateline, National Institutes of Health, Feb. 1999:

Human Genome Project scientists announced a significant breakthrough  
in cracking the genetic code today.  They disclosed that they have  
solved the long-standing problem of why only a small fraction of the  
DNA strand is actually used by the cell to code for proteins, while  
the rest seems to be just unused "junk".

The crux of the discovery was the amino acid sequence:

ATGCATGGACTGATCTAGTCATGCTGACTGGTACATACCGAATCAGTACCATGGACATATACAGTAC
GTTACCGTGACCTCAGTCAATGGCCATCTCGTGACTTCGATCTACTGAAATCCATGATCATAGCATG
ATCAGTCCTACGTAGCATGCAATGCATGCATATAGCATATCACATTATACGACTACGTACATGACGT
ACCGTAGTACATCAGG

which was found to decode to:

"this space intentionally left blank."

| RHF Joke Archives |